Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone AK0197
Clone ID AK0197
Vector pGT0lxr
Project sanger

Sequence tag AK0197
Sequence
TAAAGCCGGGGATCAGGGATCCTCCAGATGTTTAAGGACTACCCGCCCCTCCACTCATCACTGCCTCCTTTCTTGCCAGG
CAACTATTGGCCTGATCCGGAACCTGGCTCTGTGCCCAGCCAACCATGCCCCTCTGCAGGAGGCCGCGGTCATTCCCCGC
CTCGTCCAGCTGTTGGTCAAGGCCCACCAGGACGCCCAGCGCCATGTGGCTGCAGGCACCCAGCAGCCCTACACGGATGG
TGTGAGGATGGAGGAGATCGTGGAAGGCTGCACCGGAGCCCTGCACATCCTCGCCCGGGATCCCATGAACCGCATGGAGA
TCTTCCGGCTCAACACCATTCCCCTGTTTGTCCAG
Sequence Type mRNA
Unitrap ID UNI2261

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 100238037..100238391 355
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000001552 (Jup) NM_010593 junction plakoglobin Gene [Source:MGI (curated);Acc:Jup-001]

 
Come back to gene ENSMUSG00000001552


For any suggestions or comments, please send an email to unitrap@crg.es