Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST13172F11
Clone ID IST13172F11
Vector VICTR74
Project tigm

Sequence tag IST13172F11BBF1
Sequence
CTCTTCCGAAGGTGCAGAGTTCAGGTCCCAGCAACCACATGGTGGCTCACAACCATCCGTAACAAGATCTGT
Sequence Type genomic DNA
Unitrap ID UNI2503 UNI9274 UNI28219 UNI31285 UNI31286

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 10: 55943437..55943507 67
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000078446 (AC153521.7)  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 22459956..22460026 67
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 12: 16929847..16929917 67
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000020580 (Rock2) NM_009072 Rho-associated coiled-coil containing protein kinase 2 Gene [Source:MGI Symbol;Acc:MGI:107926]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 13: 55808961..55809031 67
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 15: 98833862..98833932 67
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 16: 89801352..89801422 67
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 19: 3206639..3206709 67
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 181692572..181692642 67
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 84666088..84666158 67
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 86449434..86449504 67
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000038024 (Dennd4c) NP_001074483 DENN/MADD domain containing 4C Gene [Source:MGI (curated);Acc:Dennd4c-001]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 33698228..33698298 67
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000079562 (Maea) NM_021500 macrophage erythroblast attacher Gene [Source:MGI Symbol;Acc:MGI:1891748]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 6: 149326559..149326629 67
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 148307840..148307910 67
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 94838154..94838224 67
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 78416235..78416305 67
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000049624 (Slc17a5) NM_172773 solute carrier family 17 (anion/sugar transporter), member 5 Gene [Source:MGI (curated);Acc:Slc17a5-001]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr X: 55003117..55003187 67
NO GENE  

 
Come back to gene ENSMUSG00000049624


For any suggestions or comments, please send an email to unitrap@crg.es