Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14278E10
Clone ID IST14278E10
Vector VICTR74
Project tigm

Sequence tag IST14278E10HMR1
Sequence
AGGGTTTATGTCCTCCTTACCCCCTGAGTGTATTTCTTGTTCCCATTGTCCGTNTCTTCACCACTGTCCCCTACTCCAAG
GTCAAGTGCTTTCTATTCACTTCCTCATATCTTGGTAAAGGATGTGGGTTATCCACACCTCACCCCACCCCAACCCTTGT
AAATGCTGGCCTAGTTCATCTGCCTCCTGGATACAAATGAAACTCTTTGTTGCANACTGCNAATCTGTCNNTGTTTGTGA
TGTGCCTAACTTGGTACCGAGTTGTGATTTANGCACCAANAGAATTTGGATTATTTAATCCTGCTGCATAATAAAATGAC
TTATCNNATGCTCATGTGC
Sequence Type genomic DNA
Unitrap ID UNI10517

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 73597459..73597797 317
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000070733 (Fryl) NM_177136 furry homolog-like (Drosophila) Gene [Source:MGI (curated);Acc:Fryl-001]

 
Come back to gene ENSMUSG00000070733


For any suggestions or comments, please send an email to unitrap@crg.es