Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST13619D5
Clone ID IST13619D5
Vector VICTR74
Project tigm

Sequence tag IST13619D5HMR1
Sequence
AAGTAACAAAGGTATTTTTACTGTATTAAAGAGGACGGGTAGCAAAATGTTTTTGTGTGTGTGTGTGTTTGTTTTGTTTC
ACCCATTTGTTGAATTGATAGAGTTAAATAGCTTATTTTATTTCGATGTAACTGTGGTGTTTATAGTGTTATTAAGACGC
ACAGTTCCATAACCTAAATGATAATTTTCACATCGCGTGAATGAACAGTAGCTGCTCCTGTAGTAATTCATGGAATTAAA
AAAGTGCTGCTCAACTTTTGTATTCANAGAGGATGCTTATGTCATGAGCGTTNACAC
Sequence Type genomic DNA
Unitrap ID UNI2855

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 121259687..121259982 292
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000055723 (Rras2) NM_025846 related RAS viral (r-ras) oncogene homolog 2 Gene [Source:MGI Symbol;Acc:MGI:1914172]


Sequence tag IST13619D5BBF1
Sequence
ACTTANCAGGGTACCTGCGCTCTCTTCCCAACATATGCCACGCCTTTCAGGGTGACAAAAGCANGGANATCTGT
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser

 
Come back to gene ENSMUSG00000055723


For any suggestions or comments, please send an email to unitrap@crg.es