Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST11089B8
Clone ID IST11089B8
Vector VICTR76
Project tigm

Sequence tag IST11089B8BBF1
Sequence
ACTGGAAAGGAGTTCCAAGAAGACTGGTTATATTTTTCATTTATTATGCATTCTTTAAAGATTTATTTATTATTATATGT
AAGTACACTGTAGCTGTCTTCAGACACACCAGAAGAGGGAGTCAGATCTG
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser


Sequence tag IST11089B8HMF2
Sequence
TTCTCCTGTATTTCTTTAAGTGATTTATTAAAGTCCTTCTTGATGCCCTCTACCATCATCATGAGATATGCTTTTAAATC
TAGGTCTAGGTTCTCAGGTGTGTTGGGGTTCCCTGGACTGGGCGAAGTGGGTGTGCTGGGTTCTGGTGATGGTGAGTGGT
CTTGGTTCCTGTTAGTAAGATTCCTCCGTTTACCTTTCGCCATCTGGTAATCTCTGGAGTTAGTAGTTATAGTTCC

Sequence Type genomic DNA
Unitrap ID UNI4014 UNI32291

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 1: 100263942..100264175 234
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 12: 33102271..33102504 234
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 14: 35520912..35521145 234
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000041408 (Wapal) NM_001004436 wings apart-like homolog (Drosophila) Gene [Source:MGI (curated);Acc:Wapal-001]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 15: 4621633..4621866 234
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 52990810..52991043 234
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 51666612..51666845 234
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 29504203..29504436 234
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 6: 73295803..73296036 234
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 62340824..62341057 234
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000063297 (Luzp2) NM_178705 leucine zipper protein 2 Gene [Source:MGI Symbol;Acc:MGI:1889615]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr X: 138260805..138261038 234
NO GENE  

 
Come back to gene ENSMUSG00000063297


For any suggestions or comments, please send an email to unitrap@crg.es