Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST11653B2
Clone ID IST11653B2
Vector VICTR76
Project tigm

Sequence tag IST11653B2HMF1
Sequence
ACTTTATAGAGAAGGAAACAGACTCAGGCAAAGCCACTTGTAGAATCACATGGTGATTGTTGGA
Sequence Type genomic DNA
Unitrap ID UNI23051

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 4967913..4967975 63
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000051184 (Zfp524) NM_025324 zinc finger protein 524 Gene [Source:MGI Symbol;Acc:MGI:1916740]


Sequence tag IST11653B2HMR1
Sequence
NNANGTTNTTGGGAGAATCGACAGGAATGAGGAAGCTTCAAAAATGTCCTTANTGCACAGTCTANAAAATAGAAAGCTCC
AGGACTTTCCCCAGTGCCCACAAGATCCCAGGATAGTAGGAATTGAGTGTACTTGGGGTCAAAGGTCAAAGGTGCAGCTA
GCAGCAGATTCTGTCGGGGGACCCTGCACCCNTCTTTTTATTATTTTATTGTTTGGTTGGTTTAAAGTTTTGTGTGTGGT
GTTGNCTATCCTAANCNNGGCCTCACACATACTGGNCNNGANCTACNCCCCNNAAACTTGCACCCNCTTTNAAN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser

 
Come back to gene ENSMUSG00000051184


For any suggestions or comments, please send an email to unitrap@crg.es