Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone AK0181
Clone ID AK0181
Vector pGT0lxr
Project sanger

Sequence tag AK0181
Sequence
TCTGCAGACATTCTGAGGCTCTGCAAGTACAGGGATATCCTTCTCAGTGAGATTCTGATGAATGGTCTCACCGAGTTACA
GTTCAATTCAATTTGGAAAAAAGTTTCTGATATTCTTCTGCGCCTTGGGATGAAACAAGACGATATTGACAAAGTCAAGG
AGAATCCCATTGAGAATATCTCCCTTGATTATCATCAGCTGTCCATTTATCTAGGCATACCAGTACCAGAAATCATCCAG
AGGATGTTATCCTGCTATCAACAAGGAATTACTCTACAGTCAATAACAGGCAGTCAGCGTTTAGATGTAGAAGAGTTCCA
GAATGATGAAGAAGACTTGAGTCCACCTGTGATGGAATATAATATCGATGTGAAATCAAACACTGAGATACAGTTAGCAG
AGATAAATAAAGATGTAGCCTCGATACCTAGTGAATCTTCAACAGAATCTGTTAAAGATCTTCAGGAGGTCAAAAGTAAA
ACAAAGAAGAAGAAAAGAACTAAGAGTAATAAAAAG
Sequence Type mRNA
Unitrap ID UNI2265

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 16: 48947788..48951920 267
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000064061 (Dzip3) NM_027341 DAZ interacting protein 3, zinc finger Gene [Source:MGI (curated);Acc:Dzip3-001]

 
Come back to gene ENSMUSG00000064061


For any suggestions or comments, please send an email to unitrap@crg.es