Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14560B2
Clone ID IST14560B2
Vector VICTR74
Project tigm

Sequence tag IST14560B2HMR1
Sequence
NNNTCNCCACAGCCCTGTGGCTTCCTAGTGTACNNGGACTCGAGTTGGCCTGTCCCAGAGGTGGCTGTGCGGGGAGGGGC
TTGCATCTACCACCAACAGACTGTGGGCCTGGGTCCCTGGGCCTCTGCAAGCCTTTGTCCTCCCACAACTTGGGTTTTCT
CCTCTCACCCTTCCTAGGCTATGTTTTGTGCTATGGGTCTACTGTANACACGGGTGCTCCCTGANACTTTCCTGGGCTTA
TANCCTGGCTTTGTACCAAAGGAGGGGAGGGGGTAGGTGGAGTGCCCNGCTTCCGCTGGTTCNCNCNNNGCCNNCTN
Sequence Type genomic DNA
Unitrap ID UNI20147

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 148230812..148231111 278
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000028977 (Casz1) NM_027195 castor homolog 1, zinc finger (Drosophila) Gene [Source:MGI (curated);Acc:Casz1-004]


Sequence tag IST14560B2BBF1
Sequence
NTGACCAAAAACCAGGGCTTGCCANCCTCTAATTCCACAGTGAAACAGCTCTGAGTGTCGGTCANCTACCTATTCCCGTG
GCGATCAANACACAAGGCGGGCTGTAGGTGCANANAAAGATCAAGTACAAATCCCAGAGGGAGAGGGAGAGGGAGGCAGG
CCTGTGCCTTTAAAAGAATTTTCATTTAAAGGCTCTTCTCTCTTCCACCATTTCAGTGATCTATATGCAAATATGCTAAT
GCATGCAAATTAAGACACCACTTTTAGTCCCAATTTAATAGAAAGCATTAAAATACCATTTTTTTTTCCAAAAAACTCCA
TATGCNTGAAGGAAGGTNTTTTTTTTTNNTTTNNCCNTTTTTTTTTTTN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 148230448..148230814 339
NO GENE  


Sequence tag IST14560B2HMF1
Sequence
GTGACCAAGAACCAGGGCTTGCCAGCCTCTAATTCNACAGTGAAACAGCTCTGNNNGNNGGTCAGCTACCTATTCCCGTG
GCGATCAAGACACAAGGCGGGCTGTAGGTGCAGAGAAAGATCAAGTACAAATCCCAGAGGGAGAGGGAGAGGGAGGCAGG
CCTGTGCCTTTAAAAGAATTTTCATTTAAAGGCTCTTCTCTCTTCCACCATTTCAGTGATCTATATGCAAATATGCTAAT
GCATGCAAATTAAGACACCACTTTTAGTCCCAATTTAATAGAAAGCATTAAAATACCATTTTTTTTTCCAAAAAACTCNA
TATGCNTGAAGGAAGGTTTTTTTTTTTNNNTTTCCCTTTTTTTTTTTTTTTTTTTTTTTNTTN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 148230433..148230815 355
NO GENE  

 
Come back to gene ENSMUSG00000028977


For any suggestions or comments, please send an email to unitrap@crg.es