Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14965G9
Clone ID IST14965G9
Vector VICTR76
Project tigm

Sequence tag IST14965G9HMR1
Sequence
ATCCTAAGGCTAGCATGTTTTCCCCTTTTGTGGGGGAAAAGCCAAGCCGGGGTCATTTTGACATGCCTTGGGTGTTGCGG
GGAGACAGAAGTGAGGAGGGTGTCTGGACTGGTGGGTGCTGACTGCCTTGGGCCCTGTGGTGTGGGAGGGAGAGATTCTG
CNNTGACCAACACANCCTTCTTTCTTCCTTANAGGGCAATGCNAGCAAGCTGGTGAAGGTCTTCCTTCTCTTCNCCATGG
TCN
Sequence Type genomic DNA
Unitrap ID UNI23040

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 14: 55027836..55028077 230
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000000958 (Slc7a7) NM_011405 solute carrier family 7 (cationic amino acid transporter, y+ system), member 7 Gene [Source:MGI Symbol;Acc:MGI:1337120]


Sequence tag IST14965G9BBF1
Sequence
NNGNNNNGGCANANCTNAGCNNANNNANNNNNGTNNNNNNNNNGTGTTNNNNNNNNNNATTTGCNTGAATGAGGCAGTTT
GGTAAAACTTTTTTCTGCCTCCCCCTGACCCCCAAAGTCTCTCCCCTCTGATTTCAGTTTCAAATGTCCCTGCGCTGAGA
TGCCTGTATGAGGAACCAACCCTGAAACCAACTGATTCGCTAGATCCTCTTTTTGCTGATTTGCTGTTCTTTCCCCTAAG
GAGTCTGTGTNCNGNNCTGAANCTTTTTAAAGCGCTCCTGCTNCNGATGCNCAN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser


Sequence tag IST14965G9HMF1
Sequence
AGGATGTANNNTANNNTANTNANCNNACAGCTGANNCNNNNNNCTGTTATNACNCNNGACAGGCNTGAATGANGCAGTTT
GGTAAAACTTTTTTCTGCCTCCCCCTGACCCCCAAAGTCTCTCCCCTCTGATTTCAGTTTCAAATGTCCCTGCGCTGANA
TGCCTGTATGAGGAACCAACCCTGAAACCAACTGATTCGCTAGATCCTCTTTTTGCTGATTTGCTGTTCTTTCCCCTAAG
GAGTCTGTGTGCTGGGCTGAAGCTTTTAAAGCGCTCCTGCTNCGGATGCNCNNCCNCCTCCCTGCN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser

 
Come back to gene ENSMUSG00000000958


For any suggestions or comments, please send an email to unitrap@crg.es