Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone CMHD-GT_141.1E11-3
Clone ID CMHD-GT_141.1E11-3
Vector Gep-SD5
Project cmhd

Sequence tag CMHD-GT_141.1E11-3
Sequence
ATGACAGTCATGTCCCTCTCCAGGGACCTCAAGGACGACTTTCACAGTGACACAGTACTCTCCATCTTAAATGAGCAGCG
CATTCGGGGCATCTTATGTGATGTCACCATCATCGTGGAAGACACCAAGTTTAAAGCCCACAGCAATGTCCTGGCCGCCT
CAAGTCTTTATTTCAAAAACATCTTTTGGAGCCATACGATCTGCATTTCCAGTCACGTCTTGGAGCTGGATGATCTGAAA
GCCGAAGTGTTTACAGAAATACTTAATTATATCTACAGCTCTACCGTTGTGGTCAAAAGACAGGAAACCGTCACTGATCT
TGCAGCTGCAAGGAAAAAGCTGGGAATATCATTCTTAGAAGACCTTAGTGACCGCCACTTCTC
Sequence Type mRNA
Unitrap ID UNI14064

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 96589066..96589448 379
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000040433 (Zbtb38) NM_175537 zinc finger and BTB domain containing 38 Gene [Source:MGI Symbol;Acc:MGI:2442866]

 
Come back to gene ENSMUSG00000040433


For any suggestions or comments, please send an email to unitrap@crg.es