Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST12126B6
Clone ID IST12126B6
Vector VICTR76
Project tigm

Sequence tag IST12126B6HMF1
Sequence
CTACTTGCTCTACTGCCNGAACCCTCGGCATCGGGGCCGCGTTTACGTTGGATTCACTGTCAATCCTGCTCGTCGGGTCC
GGCAACACAACGCGGGTCGCAAGAAAGGTGGAGCATGGCGGACCANCGGGCGAGGACCCTGGTAANAAGGCGCGGGTGTC
TGGTCGGAAGGCTCCGCNTANGANGCNGNCCNNTAGGGCNNANGANTNACN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser


Sequence tag IST12126B6BBF1
Sequence
CTACTTGCTCTACTGCCAGAACCCTCGGCATCGGGGCCGCGTTTACGTTGGATTCACTGTCAATCCTGCTCGTCGGGTCC
GGCAACACAACGCGGGTCGCAAGAAAGGTGGAGCATGGCGGACCAGCGGGCGAGGACCCTGGTAAGAAGGCGCGGGTGTC
TGGTCGGAAGGCTCCGCGTAGGAGGCGGGCCGCTAGGGCAAAGGAGTGACAGAGGCGGGACCGGTTTTTTTTTTTTTTTT
TTTTTA
Sequence Type genomic DNA
Unitrap ID UNI31406

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 133838835..133839079 245
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000059772 (Giyd2) NM_029420 GIY-YIG domain containing 2 Gene [Source:MGI (curated);Acc:Giyd2-001]

 
Come back to gene ENSMUSG00000059772


For any suggestions or comments, please send an email to unitrap@crg.es