Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14682C6
Clone ID IST14682C6
Vector VICTR74
Project tigm

Sequence tag IST14682C6HMR1
Sequence
AGTGCTGACAAGATGTCAATAAACTTATTTTCNTACAATTAACTTGAGGCTCTGAGACAGGCCTTGGGAGTCCAGCACTT
ANGGACTGCTCCACCCCGCCCCANANGACATGCCTCCTGAACTTGAGGCAGGTGATTGCCCCTCTAAAAGCCTTAACTAA
CCCTGGTGCAGAAGCACACACTTGAAGGTTGCAACAAACAGAGTTTATCTAGGTCTGTTAAGAGCAGTTCAATAAAGTAA
TTGGGTANTTC
Sequence Type genomic DNA
Unitrap ID UNI34135

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 19587074..19587323 240
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000048481 (P42pop) NM_145579 Myb protein P42POP Gene [Source:MGI Symbol;Acc:MGI:2446472]

 
Come back to gene ENSMUSG00000048481


For any suggestions or comments, please send an email to unitrap@crg.es