Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST11083A4
Clone ID IST11083A4
Vector VICTR76
Project tigm

Sequence tag IST11083A4HMF2
Sequence
ATGATAATAATAATAATAATAATAATGACAGAAAATACGCATCCATAAAAGAATTATCAAGTAAACACAACACTCACTGT
AGTAAACAAAAGCATTCTTAGTATCACACTCCTTTTCCAGTATAACATCCCTTACAGTTCTAGAGATACTTTCAGCAGCC
ATTGCATAAGAAAAGAGAAGTTGTTGAAATGTAAATGAAGAAAATATCTAATAAAAAATTGAGAAAGAAAGAAAGAAAGA
AAGAAAGAAAGAAAGAAAGAAAGAAAGAAAGAAAGAAAGAGAGAGAGAAAGAAAAGAGAAGTTGTTAAGCCAGGCAGTTA
TGGCTTTGATTCCAGCTCTCAGGAGGCGAAATCAGGCCAGCCTGGTCTACAGATTGAGTTTCCAGACAGCCNNNGCTACA
CAGAGAAACCCTGTCTTGGATAAAACAAAACAGAACCCCAAAACAACAACAACAACACAGAAAAAAGAANNNNNGGANGC
TNAGTCGTGANNNANAANGTTTNANAGGTCTCTTGNTTGGN

Sequence Type genomic DNA
Unitrap ID UNI33507

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 51908228..51908747 484
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000053475 (Tnfaip6) NM_009398 tumor necrosis factor alpha induced protein 6 Gene [Source:MGI (curated);Acc:Tnfaip6-001]


Sequence tag IST11083A4BBF1
Sequence
GGACGATTATGAATTTGAGGCGAGTCTGGGCTACACAGTGAGATCCTGCTTCAAAACAAGCAAGCAAACAAAAAAATAAC
AAAAGGTTTTTAACTAGCTCACAGGAATGCAGGTTAGAGAAAAAAATTAAAAATTAAAAACCTATCAAGCAGGCATTGTA
GCACCTCCCCAGTTCTATCACTGTAGAGACTGAGATGGGGGAATCTTATGTCAGAGGCTAGCCTTACCCATGTATTGAGT
TTGAAGCCAGCCTGGGCTATATCACAGTAGCTTCTCCAACCACAGTATAATNAAATTAGAAAAGCAGAAAAATAACAAGC
CTCTCCAAAGTGGTAAATTCTGCATAAATAATTCCCAGATTTAAAAAAGGCAGTCTTAAGGTTTTTGTTTTTTGTTGTTG
NTTTTGTTTTGTTTGTTTTGTTTCATTTTGTTTTGNTTNAAAAAGANGTAGAAAGAAATGACAGTACAAAAAATATTGAC
ATCTGTAAGGTGTAGCTNNNGTAGATCTG
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 6: 67183206..67183713 492
 
EST/CDNA Est Name
  AV103242.1

 
Come back to gene AV103242.1


For any suggestions or comments, please send an email to unitrap@crg.es