Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14562B4
Clone ID IST14562B4
Vector VICTR74
Project tigm

Sequence tag IST14562B4HMF1
Sequence
GATTCTCTCTCCCTCATCCTCTCTTCTCTGTCCCGTGTCATCAGAACACGTCTCATAGGCCAATCCTGATCACAGCAGCA
GGCCTTCAAGGGGCTGCCTCAGTCAGTCCTGACCGACTGTCTGCAAAGGCTCTGGTGGGAAGCCACACCCTGCCCCAGCT
CCCTGGGTTCCTCGCCACTTGGAACAATGAAACTCAGATGACCTATACATGCTGGGACAGCTGAGGCAGGGGACAAGCCA
ATGAGCCTCGCCTCTTCCTCCTCCTCCTCCTCTTCCTCTTTCCTCCTCCTCTTCCTCTTCCTCCTCCTCCCATTCCCTCC
TCCCAGCCAGCTCTGTGTGACCACCTGACCCCTAGTTTGACCCAAATAATAGACCGCCTTTTCTTTTCTTTTTTTTAAAG
CTCTAGGATGCTCTCTTTTCTTTCANGCGCCTCTANGAAGTGCTATTTTATGACTTCCTGGCCAGC
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 165699978..165700442 461
 
EST/CDNA Est Name
  AK003657.1


Sequence tag IST14562B4HMR1
Sequence
AATCCNTAAAGAGGGGGGCCGGGTGGTGTTGGGTCTTCATCTTTGTCTGTCTGTCCATCTGTCTTCTGTTTACTTCCCTT
TCTTTTTCTTTTTGGAGGCAGGGTCTCACGACACAGCTCTGGCTGGCTTANAACTCACTCTGTANATCCTGTTGGTTTTG
AACTCACAGAAATCCACCTGCCTCTGCCTCTGCCTCTGCCTCCTGANTGCTGGAGTTAAAGGTGTGTACTTGCTATTTCA
GGTGCCTCCTACCTAAGGCTGTCTANNATAAAGGTACTGGTATGTTTGAAGGCTTGTGGGACAACNCAGGN
Sequence Type genomic DNA
Unitrap ID UNI15045

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 165699672..165699981 296
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000039671 (Prkcbp1) NP_081506 protein kinase C binding protein 1 Gene [Source:MGI (curated);Acc:Prkcbp1-010]

 
Come back to gene ENSMUSG00000039671


For any suggestions or comments, please send an email to unitrap@crg.es