Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST12247H3
Clone ID IST12247H3
Vector VICTR76
Project tigm

Sequence tag IST12247H3BBF1
Sequence
CACTTAACTTTCNNACTACACAACTGCAGCACAAACTCGGGTAACAAAACCATTACTGTTCCTTGTAGCGCTTCCTGGGC
AAACTGCCCTTAGCCCCACCCATCACGGACAAACCCGGCTCACTGAGACGCAAGAGACGCGTCGTTCTGCGTTTTCCAAT
CAGAGCCACACTTCTGAACTTTGACCGCCCAACTTGGCAAGCTCCGCCCAGTGCAGACCATCCCCGCCCACAGAGAGGCG
CTTTGCTCCCTGTTTGCTCTTAAGCGCGGTGCTTGCAAACTTTAACCGCTGGCGCCAGGTCTACACGCATGCGCCATCCT
TTGAATGCTGAGCATTCTGATTCTAGCTGCTACAGCCGCAGGGCTAGTGATCTTGCTATTCCAGCGACTATGGACCGTGC
TTGGGCCCCATCACGTCACTCCCCGANAGTCTCTCAGACTCTTGATCGTGGCTGGATCT
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 120994442..120994899 452
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000039887 (AC105336.14) NM_024178 UDP-N-acetylglucosamine transferase subunit ALG14 homolog [Source:UniProtKB/Swiss-Prot;Acc:Q9D081]


Sequence tag IST12247H3HMF1
Sequence
CACTTAACTTTCCAACTACACAACTGCAGCACAAACTCGGGTAACAAAACCATTACTGTTCCTTGTAGCGCTTCCTGGGC
AAACTGCCCTTAGCCCCACCCATCACGGACAAACCCGGCTCACTGAGACGCAAGAGACGCGTCGTTCTGCGTTTTCCAAT
CAGAGCCACACTTCTGAACTTTGACCGCCCAACTTGGCAAGCTCCGCCCAGTGCAGACCATCCCCGCCCACAGAGAGGCG
CTTTGCTCCCTGTTTGCTCTTAAGCGCGGTGCTTGCAAACTTTAACCGCTGGCGCCAGGTCTACACGCATGCGCCATCCT
TTGAATGCTGAGCATTCTGATTCTAGCTGCTACAGCCGCAGGGCTAGTGATCTTGCTATTCCAGCGACTATGGACCGTGC
TTGGGCNCCATNACGTCACTCCCCGANAGTCTCTCAGACTCTTGATCGTGGCTGGATCCGGTAAGTATCCGGGCGGANGC
CGACGGTCTTGANTTAGGCACTACAAACCCCAGAATGCATCGCGN
Sequence Type genomic DNA
Unitrap ID UNI34137

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 120994442..120994965 514
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000039887 (AC105336.14) NM_024178 UDP-N-acetylglucosamine transferase subunit ALG14 homolog [Source:UniProtKB/Swiss-Prot;Acc:Q9D081]

 
Come back to gene ENSMUSG00000039887


For any suggestions or comments, please send an email to unitrap@crg.es