Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone CMHD-GT_132E12-3
Clone ID CMHD-GT_132E12-3
Vector Gep-SD5
Project cmhd

Sequence tag CMHD-GT_132E12-3
Sequence
AACTGGCCTATGATCTGGATGTGGACGATGCTCCGGGGAACAAGCAGCATGGAAATCAGAAGGACAACGAGATCACCACC
TCTCACAGCGTGGGGAACATGCCGTCCCCACTGAAGATCCTCATCAGTGTGGCCATCTATGTGGCGTGCTTTTTTTT
Sequence Type mRNA
Unitrap ID UNI9144

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr X: 49625975..49626131 157
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000055653 (Gpc3) NM_016697 glypican 3 Gene [Source:MGI (curated);Acc:Gpc3-001]

 
Come back to gene ENSMUSG00000055653


For any suggestions or comments, please send an email to unitrap@crg.es