Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14702A2
Clone ID IST14702A2
Vector VICTR76
Project tigm

Sequence tag IST14702A2HMR1
Sequence
ATACACAGTAAATACATATAATATAATATAATATAATATAATATAATATAATATAATATAATGTTGAGAGACAAGCCAGG
CCAGGCATGTTCACATTCCTGTAATTCTATCTTGGGAGGTAGAGACAGGATTTCCAGGGCAAGCTGGTTC
Sequence Type genomic DNA
Unitrap ID UNI29473

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 30977325..30977473 149
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000075415 (Fnbp1) NM_019406 formin binding protein 1 Gene [Source:MGI (curated);Acc:Fnbp1-001]


Sequence tag IST14702A2BBF1
Sequence
GTATGTTTGTGGACATGGCACAGTGCTTATGTGAAGGTCAGAGGGTAACGTATGGGATTAGGCTCTCTGTCCATCATGTG
GGTCCAGGGGCTCAGACTCAAGTCAGCGCAGGTTTGGCAGCAAGCATCTTTACCTGACAAGCCTTGTGGCCTCTGTTCAT
CTGTTTTTGTAGTACTAGAGATACTAGGTAAATGTAGTTAGTATGCCTAGGCCACACCCCAGCCCTGTTTTCTTTCTTCT
TTTTCTTTGAAACAGGGTTTCTCAGTGTAGCCCTGGCTGTCCTGGAACTCACTCTGTANACCAGGCTGGCCTCAAACTCA
GAAATCCACCTGCCTCTGCCTCCCGAGTGCTGGGATTAAAGGCATGCACCACCACTGGCTGGCTTTCTATTTTCTTTTAA
TCTTTANACTTTCTGTTTGGCTTGTTTGTTTGTTTGTTGAGACNAGATCTG
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 30977470..30977919 444
 
EST/CDNA Est Name
  BI409029.1 - BY748418.1 - BG242630.1 - CD550220.1 - BE288421.1 - BY241837.1 - BY237845.1 - BB850099.1 - CJ186961.1 - BY237301.1 - BY289585.1 - BY297428.1 - BY215370.1 - BY130346.1 - BY216838.1 - BY233334.1 - BY209407.1 - BY015615.1 - BY268166.1 - BY127928


Sequence tag IST14702A2HMF1
Sequence
GTATGTTTGTGGACATGGCACAGTGCTTATGTGAAGGTCAGAGGGTAACGTATGGGATTAGGCTCTCTGTCCATCATGTG
GGTCCAGGGGCTCAGACTCAAGTCAGCGCAGGTTTGGCAGCAAGCATCTTTACCTGACAAGCCTTGTGGCCTCTGTTCAT
CTGTTTTTGTAGTACTAGAGATACTAGGTAAATGTAGTTAGTATGCCTAGGCCACACCCCAGCCCTGTTTTCTTTCTTCT
TTTTCTTTGAAACAGGGTTTCTCANTGTANCCCTGGCTGTCCTGGAACTCACTCTGTAGACCANGCN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 30977470..30977775 300
 
EST/CDNA Est Name
  BY241837.1 - BY237845.1 - BB850099.1 - BY237301.1 - BY289585.1 - BY297428.1 - BY215370.1 - BY130346.1 - BY216838.1 - BY233334.1 - BY209407.1 - BY015615.1 - BY268166.1 - BY127928.1 - BY338249.1 - BY343807.1 - BY220999.1 - BY342669.1 - BY223600.1 - BY336736

 
Come back to gene BY241837.1 - BY237845.1 - BB850099.1 - BY237301.1 - BY289585.1 - BY297428.1 - BY215370.1 - BY130346.1 - BY216838.1 - BY233334.1 - BY209407.1 - BY015615.1 - BY268166.1 - BY127928.1 - BY338249.1 - BY343807.1 - BY220999.1 - BY342669.1 - BY223600.1 - BY336736


For any suggestions or comments, please send an email to unitrap@crg.es