Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST12982D2
Clone ID IST12982D2
Vector VICTR76
Project tigm

Sequence tag IST12982D2HMF1
Sequence
CTANAAGTCNNNGCGGGCCCGCGTGCGTCCTGGGGCCTGAGTGTGGAGGCCGAGGAGGAACGGTGGCGGCCCCTGCTGTT
GCTGCTGTTGCTGCTACTGCTACCGCCGCCGCTGCCGCCTCTGTTTCTGACCCCCTTGTGCCCATCCCAAGAGGGAGGTC
ANAGTGTCCATGTGCCTAACGGGAAACAGGAAGGAGTACACTCTTTANTGTCTGTCCCGGCCCCAAAGGGCTCACATTCC
TATACCGTTATGGGGCGTGTTTGGA
Sequence Type genomic DNA
Unitrap ID UNI14367

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 95119548..95119811 250
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000015714 (Lass2) NM_029789 LAG1 homolog, ceramide synthase 2 Gene [Source:MGI (curated);Acc:Lass2-001]


Sequence tag IST12982D2BBF1
Sequence
CTTATANAGTAANACCCCTGGGTTANAGCCNCAGGAGTGTGTAAGCCTTCCATGATGTCATTTACCTGTGAGTCAAAAGT
ACAAGGATCTANAGTTCCTGGCTATTTTCCCCAAATACAGGCCTTAAAAAAATTAAAGCCCCAGGAGTGGTTGTGGTAAA
AACACCTTTAATCCTGTAATCCCTGCCCTAGGAGGCANAANTAACCTGATCTCANTGAATTCANACCCNNCCTGGTCNAA
AANCAANTCCCAGGCNNNCTAAATCCNCACAATGAAATAAAAACAANCTCCNCACNNTTTNANNTTTGNTNGNTN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser

 
Come back to gene ENSMUSG00000015714


For any suggestions or comments, please send an email to unitrap@crg.es