Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST15067H4
Clone ID IST15067H4
Vector VICTR80
Project tigm

Sequence tag IST15067H4HMF2
Sequence
GGACAACCAGGGCTACAGAATGAAACCCAGGGGCTCACACCTACCTAATGCACCAGGCACAACATGGTACACAGATATGC
AAGGCAAAACACCCATGCACATAAAATAATTAAACAAGTAATCTCAAAAACAAAAAAAACTTAATTAGAAAGACAGCTCA
GTGGTTAANATCACTTGCTGCCCATTCAGACAATCAGGGTGCAGTGCCCAGCACCACATGGCAGCTCACAACTGTCTGTA
ATTCTGATTCCAGGATATCAGGTGCTTTCTTCTGCCCTCCATATTTACCAAGCACACATGAAATGCATTTACATACATGT
ATGGAGGCAAGACAGTCATACACATAAAATGAACATAAATAAAATCTTTTTTTTTAAACTGAAGCAGGCCAGGTGTGGTG
ACACAGGCCTTTGACCCTAGTACATAAGCGACAGTCCAGCCTANGCTACATAGTAAGANCCCGTCTTANNCAAAACAAAA
ANNAACCAAACTCCAAAGCGGGTGGNCTGTATGTCANTGATGGGGCTTGCCCGGGGAANNANCCANANANNAANTNNAAN
GAAAN
Sequence Type genomic DNA
Unitrap ID UNI19062

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr X: 7818466..7819029 524
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000031171 (Ftsj1) NM_133991 FtsJ homolog 1 (E. coli) Gene [Source:MGI (curated);Acc:Ftsj1-001]


Sequence tag IST15067H4BBF1
Sequence
GGACAACCAGGGCTACAGAATGAAACCCAGGGGCTCACACCTACCTAATGCACCAGGCACAACATGGTACACAGATATGC
AAGGCAAAACACCCATGCACATAAAATAATTAAACAAGTAATCTCAAAAACAAAAAAAACTTAATTAGAAAGACAGCTCA
GTGGTTAANATCACTTGCTGCCCATTCANACAATCAGGGTGCAGTGCCCAGCACCACATGGCAGCTCACAACTGTCTGTA
ATTCTGATTCCAGGATATCAGGTGCTTTCTTCTGCCCTCCATATTTACCAAGCACACATGAAATGCATTTACATACATGT
ATGGAGGCAAGACAGTCATACACATAAAATGAACATAAATAAAATCTTTTTTTTTAAACTGAAGCAGGCCAGGTGTGGNG
ACACAGGCCTTTGACCCTAGTACATAAGCNACAGTCCAGCCTANGCTACATAGTANNANCCCGTCTNAAGCNAAACAAAA
CNAACCAAACTCCAAAGCGGGTGGGCTGTATGTCANTGATGGGNCTTNNCCGGGGAAGGATCT
Sequence Type genomic DNA
Unitrap ID UNI19062

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr X: 7818487..7819029 509
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000031171 (Ftsj1) NM_133991 FtsJ homolog 1 (E. coli) Gene [Source:MGI (curated);Acc:Ftsj1-001]


Sequence tag IST15067H4HMR1
Sequence
NCCTGANTTAACTANNNNNANNNNCNGNNNNNNAACTCANAGATCCGCCTGCCTCTGCCA
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser

 
Come back to gene ENSMUSG00000031171


For any suggestions or comments, please send an email to unitrap@crg.es