Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14608B7
Clone ID IST14608B7
Vector VICTR74
Project tigm

Sequence tag IST14608B7HMF1
Sequence
CCATGTTTCAAAAAACAACAACAACAAACAAACAAACAAACACTTGTTGCTTTTGCAAGGGACAGGAGTTTGTTCCCAGC
ACCCATAATAGGCAATCCACAACTGCCTGTGTCTCTAGTTTCAGTAAATCTAAAGCTTTCTTCTGGCCTCTATAGGCATT
GCGCATACTCATACATACATACATACATACATACATACGCATC
Sequence Type genomic DNA
Unitrap ID UNI19344

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 134147464..134147665 202
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000030681 (Mvp) NP_542369 major vault protein Gene [Source:MGI (curated);Acc:Mvp-001]


Sequence tag IST14608B7HMR1
Sequence
ATGGTTTCTCTATATANCCCTGGCTGTCCTGAANCTN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser

 
Come back to gene ENSMUSG00000030681


For any suggestions or comments, please send an email to unitrap@crg.es