Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14579G8
Clone ID IST14579G8
Vector VICTR74
Project tigm

Sequence tag IST14579G8BBF1
Sequence
GGGTCAGGAAGAGCACCATTTTGTGGGAGGTGCACACTTTCCAAAGCTGAAGGACTTGACTCCCTCTAACCACCTGTCAA
ATCAGCCCCAGCCCCTTTCCACAGAGGAGCATGCAAGTCCAGCCCAAAGAACTCAGCGGCAAAGGAACTAAACTAGTCAC
ACCTATCCCAGAAAGAGCTGAGCGGACACTGCGCACAAGCCCACTAACAAACACCCCTCTCACATCCTAGCTCTTTAAAG
TTTACTGTTGCACATACACTCACCATCCTCAGCTCAGTGTTTCAAAAAGAGGACCATACTTGACCTAGTCACAGCTCAAG
CTAATGCCGGGCACAAAGACAGGTACTTAGTATACCCATATGAAATGAATGACCAAGTCTACCCATAGGCACACCACAAG
ANTACACAACTACACAACCACACTCGCAACGGTCCCGAACGAACAATCATAAACTCTGCATTGGNNAAGCACTTGCCCCC
TTTCGGANAGATCTG
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 126142308..126142801 486
 
EST/CDNA Est Name
  CA945444.1 - CJ130124.1


Sequence tag IST14579G8HMR1
Sequence
NCCCCCTCCCTAAGATATGCTCCGTATCCTCCCACCCCTGCCCCATCCCCCAGTCCTTTCCATGAAAGCANAGCTCTGGT
AAAGGGAGGTTCTGAGTTTATCCCTCTTCCACCTGGGCTAGTCTTCTGCAGGCAAGAACAATAGTAGCTGAGGACAAAGG
CCCCACTTANTCC
Sequence Type genomic DNA
Unitrap ID UNI10652

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 126142139..126142309 167
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000041530 (Eif2c1) NM_153403 eukaryotic translation initiation factor 2C, 1 Gene [Source:MGI (curated);Acc:Eif2c1-001]

 
Come back to gene ENSMUSG00000041530


For any suggestions or comments, please send an email to unitrap@crg.es