Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14123C2
Clone ID IST14123C2
Vector VICTR74
Project tigm

Sequence tag IST14123C2BBF1
Sequence
CCNCCTANNNNNNNGGANNNCNAAGANTCNCTCANGCTTTGTTTGNGGCNCNGNCTTGANTTNATTANNCNNTTTTNANN
TTCNNTCTGTTNNTTACTTGGCTACTCNTCCTTGCTNANANCCTTTCTTCCTTGANCCCCCCTCCTAAAGCACCCACCCT
ACCCGTTGAAAGGNATTGNCCNANCTACTTCCTCCTGGANACCCTGTCTNNGGCCNCCTCCTTCTCTAGCCNCTCCTCTT
TCCNCCTCCCCCCTCCCTTCTCTGACCTGNTTTTATGACCTCTGGACAGAAACTTCCCATTTCCTGNTGNGTCNCCCATC
CTGACCNNGCATTGANAGTTTTTCACTGACATTTGGGNNNNACTGGTTTTTANAGCCCATACCTNNNGAANACTGAATGA
N
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser


Sequence tag IST14123C2HMR1
Sequence
NTGCCTGCCNGGGGACTTGAAGTCCTAAATTTGATCCCAGCAGTGCAGAAACTAGATGTGGTGATGATGCCTGCAATTTC
AGCAGTTGAGGGATGGAGGATTAGAAATTCAAAGTCATCCTTGGCTACATAGAAAGTTCCNNGCCATCCTGGACTACNTG
AGATCTTGTGTGTGTGTGTG
Sequence Type genomic DNA
Unitrap ID UNI15257

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 52185156..52185334 171
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000020402 (Vdac1) NM_011694 voltage-dependent anion channel 1 Gene [Source:MGI (curated);Acc:Vdac1-001]

 
Come back to gene ENSMUSG00000020402


For any suggestions or comments, please send an email to unitrap@crg.es