Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST11013F5
Clone ID IST11013F5
Vector VICTR76
Project tigm

Sequence tag IST11013F5HMF1
Sequence
TTANGAAATTTGAAAGGGAGTACTTTGTCCCTTTCCAAAGAAAGAGAGAGCCATCACTGTCAGAAGCAGGCAAAGTTGTT
GCCTTTGTAAAGCAAGTTAGATTTACCCAACATAGTTAGATGAAAAGAATATGTGTGTATTATTCTGACAAGAAAGGAAT
GGCATCCTGAGGAAGGCTCCTGTGGGCTGCCTCTGTGAGCCACTGTGGCAGGGATGCTCTTTGAGTGGGAGGTTTCTGTT
CATTTGCAAATGCGATGACATTTTCNGCTTTTTGTACCAGGAACAGAAGCACCTTANGAAGCCCAGGCTGAATGCCTTCT
CCCTANANAGTANNAAATGAGGTTAATCTATTTATTGATGGAGGGTCTGGGAGTCGGGATAGGANGANGTTGCANTANGG
AGGGGCNNTGTTATGTGGA

Sequence Type genomic DNA
Unitrap ID UNI33659

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 104698894..104699310 391
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000032564 (Cpne4) NM_028719 copine IV Gene [Source:MGI (curated);Acc:Cpne4-001]

 
Come back to gene ENSMUSG00000032564


For any suggestions or comments, please send an email to unitrap@crg.es