Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14586B7
Clone ID IST14586B7
Vector VICTR74
Project tigm

Sequence tag IST14586B7HMR1
Sequence
AATAGTTNAGTAGTTCTCCNAANTTNANTCCCAGCTTCNACCAAAACTCCCCTACTTCTAAGTTGANATTTTGTGGGANA
GAAAAAGTGAAAGAGACCTTGTGTACTTGATAAAGTATTTGGCATAGTGCCTTTTTATGTGTGTGGTGCGATACAATGAA
TATTTGGAAGCTTGGGGGAGGGTTAAGTCAAATACTTGGTCTGTGCTATCNCCTTCTTGATCCCGAGAGAAGGTGTAACA
CTTAANTCAAATATGTGTCTTTTTTGGTACTAAAAATTTN
Sequence Type genomic DNA
Unitrap ID UNI10857

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 16: 36072486..36072764 259
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000075229 (Ccdc58) NM_198645 coiled-coil domain containing 58 Gene [Source:MGI Symbol;Acc:MGI:2146423]


Sequence tag IST14586B7HMF3
Sequence
GCTGCTTTGCTACAGTGCAGCAGATAACTGGGAAGTGCAGTTCTCCAACAATCTTCCTGGGGAAGTCAGAGAACTCTGAG
CTAAAGCTGCAGTGCCTGAAGATGAGGAATTATCCTATTCTGCAGTTCTATTTGCACTAAGCTATTATAAGGCAAACTTC
TTAGTATTTTATTTCAATTATAAGTGTTGGAAGCAAATTCTTAGTCCAGCCTAGGTCAGGGGTGGGCAATCCCAGGGCCC
TGGATTCCCCATCTCCCCAATTTCACTTCTGCTCCTAACCTGGGTCAGGTCCTTCTCCAGGACACTAATGAATGACCTGC
TCTCANATCTCACCCCCATTANATAGCAAGATCTTGGGAAACCAGCCACCTTGGCCAG
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 36299091..36299467 373
 
EST/CDNA Est Name
  CR758226.1 - BF715612.1


Sequence tag IST14586B7BBF2
Sequence
GCTGCTTTGCTACAGTGCAGCAGATAACTGGGAAGTGCAGTTCTCCAACAATCTTCCTGGGGAAGTCAGAGAACTCTGAG
CTAAAGCTGCAGTGCCTGAAGATGAGGAATTATCCTATTCTGCAGTTCTATTTGCACTAAGCTATTATAAGGCAAACTTC
TTAGTATTTTATTTCAATTATAAGTGTTGGAAGCAAATTCTTAGTCCAGCCTAGGTCAGGGGTGGGCAATCCCAGGGCCC
TGGATTCCCCATCTCCCCAATTTCACTTCTGCTCCTAACCTGGGTNANGTCCTTCTCCAGGACACTAANGANNGACCTGC
TCNNANATCTG
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 36299138..36299467 314
 
EST/CDNA Est Name
  CR758226.1 - BF715612.1

 
Come back to gene CR758226.1 - BF715612.1


For any suggestions or comments, please send an email to unitrap@crg.es