Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14183C4
Clone ID IST14183C4
Vector VICTR74
Project tigm

Sequence tag IST14183C4HMR1
Sequence
CCTTTTGAAACCTATCTGAACTTTTTATAATGATGGGTGGGTAAAGCATCTCCCACACTCAGAATCCCTGTCTGGGGTAA
AGACATTGGCGTTAGACTGCGGGTTTGGTTCAATCAGACTCTGTCCACACCCAGATTTCCAAGCTCTTGGGATCCCCCAG
AGAAAAATGTATTTGTTC
Sequence Type genomic DNA
Unitrap ID UNI20228

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 10: 127532603..127532779 177
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000040054 (Baz2a) NM_054078 bromodomain adjacent to zinc finger domain, 2A Gene [Source:MGI Symbol;Acc:MGI:2151152]


Sequence tag IST14183C4HMF1
Sequence
AAGGAAGATCTCTTTAAGATAAGCCAAAAATGTGGGCTCAGCACATGGTTCCTCTCCCTCAACAGAGCTAAGTAGATTAC
TAAGGGAAGGAGGAGACAGAACAAAATCTCTCTCCCCTGTCAAAATGAGTTTATAAAGTCAGTCACGGCAACCTACGCCT
GTAATTCATTCCTACACTGAAGAGGCATAGAGGAGAGGATCGCCCTGTGAGCTCAAGGCCAGCTCGGTCTACAAATCCAG
TTCCAGACTAGTCAGGACTTCATTGTGAGACTTTGTCTGGAAAAAACACAAAAGGACAAAGGTCGCCTGGGGGGATACAC
CTTATCTTTCCNAAAGCCCACTAACCTCCACGCCCTGGAGAAAGGAGAAGTAAACTTANGCCNAAAAAAAAGTGTGNCCG
GNTGTGGC
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 10: 127532200..127532606 397
NO GENE  

 
Come back to gene ENSMUSG00000040054


For any suggestions or comments, please send an email to unitrap@crg.es