Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone CMHD-GT_140A11-3
Clone ID CMHD-GT_140A11-3
Vector Gep-SD5
Project cmhd

Sequence tag CMHD-GT_140A11-3
Sequence
GAATCTGAAGCATGCGGTCTAGTTGACAAAAAGAGATCAGGTTCCCAGAGCTGGGCAGCAGTGCCTATAATGAAGACAGT
GTGTTGATGCAAGCGGTTTGTGGAATTTGTGACTGCAGGGGAAATTTGGAAGAAATTACTTCCTGAAAATTTCCAAGGGG
CACCAAGTGGCAGCTGGCCTCCTGGGGTGAGGAGCCAGGCA
Sequence Type mRNA
Unitrap ID UNI14070

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr X: 99480306..99480506 199
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000067567 (Hdac8) NM_027382 histone deacetylase 8 Gene [Source:MGI (curated);Acc:Hdac8-001]

 
Come back to gene ENSMUSG00000067567


For any suggestions or comments, please send an email to unitrap@crg.es