Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST12405C6
Clone ID IST12405C6
Vector VICTR76
Project tigm

Sequence tag IST12405C6BBF1
Sequence
GTTTTCTCTAGACAGATTTTTGGTTTTATTGTTCTGTTTTTTAAAGAAATAAAGCCTTGCAGGGCATGGTGGCATACACC
TTTAATCCCAGCACTTAAGAGGTAGAAGAAGCAGGCAGATCTG
Sequence Type genomic DNA
Unitrap ID UNI13612

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 96593579..96593700 122
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000031755 (Bbs2) NM_026116 Bardet-Biedl syndrome 2 (human) Gene [Source:MGI Symbol;Acc:MGI:2135267]


Sequence tag IST12405C6HMF1
Sequence
CTTTAGGGAATAGGCTTTCAAAAGCCAAGGAACAAAAGAGGATTTGCTTTTCCAATCCTCTGAAGCA
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 83170684..83170749 66
NO GENE  

 
Come back to gene ENSMUSG00000031755


For any suggestions or comments, please send an email to unitrap@crg.es