Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14995A3
Clone ID IST14995A3
Vector VICTR78
Project tigm

Sequence tag IST14995A3BBF1
Sequence
AAACAAACAAAAGCCCCAAACCACCAACTCTATCACTCATCACTAAGTCTTCTGGTTTCTACCACATACAGTCCATCCTT
TGTTTTGCTGTTAAATCTTACTATGAAGTTTCTAAGCAACTATCATACAAACTCTGAGTGAGTTTATAAGGTCGCTCTCT
CTTAGGTTAAGAGCTATAGTCTAGCATTTTCTATGAGGACAGGCAGATGTTCAACAAGGGAAAAAGTACTAAAGCGAAAC
CCTGATTGCAGCCCTTGATTAAAGCCAGCATAGCACTGTCTCTCTCTCCCCTTGTTCTCCATTATTATATAAAGGGTTGT
TTTGTTTCGTCTTTCCCCNTAGCAATCCATTTGGATTGGACAGCTGGTAAGTATAAATCTCTCTATATATACTTATCAAA
NNNTGCTGCANTGCATCTTTCTGTCCTANCCTGCNNATAGCTGGAANCCNNNCNCACTCTCCTATCTTTGTNCTCCNTTG
CNNNATGTCTGCANACNNCANGN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 42840989..42841484 458
 
EST/CDNA Est Name
  CA886077.1


Sequence tag IST14995A3HMR1
Sequence
GTTTGTTTTAATTTATAATTGTTGTTCAGACAATATCTCATGTAGTCCTCACTGGCCTCAGATTCATTCTGTANCTGGGC
CTGGGTTC
Sequence Type genomic DNA
Unitrap ID UNI19528

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 42840906..42840992 85
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000059495 (Arhgef12) NP_081420 Rho guanine nucleotide exchange factor (GEF) 12 Gene [Source:MGI Symbol;Acc:MGI:1916882]

 
Come back to gene ENSMUSG00000059495


For any suggestions or comments, please send an email to unitrap@crg.es