Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST15001A3
Clone ID IST15001A3
Vector VICTR78
Project tigm

Sequence tag IST15001A3HMF1
Sequence
CTCAAAGACCTTCCCAAGTACCTGGGCTGAGTCTGGGGATGTTAAAAGGAGGGTAAAGATACATGGACTGTGACCCTATC
TCAGGCTGAAACATCCCTAGGAACTGGTGATCATACACATCTGCCAAAACCCAGCATCCCAAGGTCCCCAAGGCAAGCCC
GCTTACACTGCCTAATGCTCCCTCTGTCCCCTCCAGGGCCAGTGGCCAGCCA
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 110525926..110526136 211
NO GENE  


Sequence tag IST15001A3BBF1
Sequence
CTCAAAGACCTTCCCAAGTACCTGGGCTGAGTCTGGGGATGTTAAAAGGAGGGTAAAGATACATGGACTGTGACCCTATC
TCAGGCTGAAACATCCCTAGGAACTGGTGATCATACACATCTGCCAAAACCCAGCATCCCAAGGTCCCCAAGGCAAGCCC
GCTTACACTGCCTAATGCTCCCTCTGTCCCCTCCAGGGCCAGTGGCCAGCCCTTTCCTGGGCAGGGACTAAGTGAACTGA
TACCTTAATGGTTCAGCAAACTCATANACCATACAGATCTG
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 110525926..110526205 278
 
EST/CDNA Est Name
  BY348584.1 - BB873695.1 - BQ555881.1 - W85483.1


Sequence tag IST15001A3HMR1
Sequence
TGAGATCGGGTGATTTCTATCCTGAGCTGTACCCCATGCCACCAGCTTTGGCTAGCAGGAGCCAGTTGTTACCTCCACCT
ATTTGACACAGGAGAAACTGTTCCAGCCCTGGTGTGAATCAGGATGGACACACACGCTGCCCCCAGGGACTCCTGACAGC
AGATCTGAGGATTTCTTCATATTTCTGCAGAGTTCCTCCTTCTGAGATTCAAGAGAANCNNGCTCCNAGCTCCGTCC
Sequence Type genomic DNA
Unitrap ID UNI15873

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 110525694..110525929 228
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000032491 (Nradd) NM_026012 neurotrophin receptor associated death domain Gene [Source:MGI Symbol;Acc:MGI:1914419]

 
Come back to gene ENSMUSG00000032491


For any suggestions or comments, please send an email to unitrap@crg.es