Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14148B7
Clone ID IST14148B7
Vector VICTR74
Project tigm

Sequence tag IST14148B7HMR1
Sequence
GAAGAACAAGACACAAAGGGGAACTGTAGCAGCAAAGGTTTTCTTCTTTTTAATTGCTTTCCTGGTTCACAATGTGAATG
ACTCACTAGGAAAAGAGTGTACCACGTTCAAATAAAGAATAAGCGAGCGGGGCGTGGTGGCGCAAGCCTTTAATCCCAGC
ACAT
Sequence Type genomic DNA
Unitrap ID UNI10402

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 37306393..37306556 164
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000035437 (Rabgap1) NM_001033960 RAB GTPase activating protein 1 Gene [Source:MGI (curated);Acc:Rabgap1-004]


Sequence tag IST14148B7BBF1
Sequence
CTTCACAAAACACCTAGACTCCNGNGGGACAAGAATGATGCTTCCTTTTCCTTATACACACCCATTTTTAAGTATACAAA
TAATATGAGAACTAAACTATAATCTCGTGCACTCCTATCAAAATGTTTACTAGTTTGGTGGTCAACTTCCATGTATTTCT
TGATTCGTAAGTATAGTCAAAGTACATGAGTAAATTAAGTTTTCTTAAATAAAACTATTACGTAATTAGAATGTTTGGAG
AAAAAAATTAAAAAATAGAAACAAGTTAAAACAAATTANGAACGTCACATTTCACCACCAATGCTAACATTTNAGTTTAC
AAGANCAATTTAATAATCTGATGTCTTTTTTTGACACNNNGCCTNATTGNAACTCNNNCNANCTGCAAACTTTTGATCCN
CCTGCCNCCATTTCCCANATGCTGGAATACTATTCCNGTNAGTNNTGNCNNNTTTA
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser


Sequence tag IST14148B7HMF2
Sequence
NTNNANGGNNNNNNNNNACNCNNNNGGNNNNNNANNNNNGCNTNNTTTTNNNNNNNNNNTNNNNTTTTAAGTATACAAAT
AATATGAGAACTAAACTATAATCTCNTGCACTCCTATCAAAATGTTTACTANTTTGGTGGTCC
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 37306254..37306331 74
NO GENE  

 
Come back to gene ENSMUSG00000035437


For any suggestions or comments, please send an email to unitrap@crg.es