Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST12901D9
Clone ID IST12901D9
Vector VICTR76
Project tigm

Sequence tag IST12901D9HMF1
Sequence
CAACCAGCATTCCTTANGNGCAGTGTGGTCACACNNNCNTGGCTACAGTCTTGCCCGTATCCTGTGGTCACANNNNCTTG
GCTACATTCTTGCCCATTCTATTACTGGTAGGTATACATGGANNTNNNATACTTTGTCCTTGATTAAACTGAGAGAATTA
TAGTCTCACACAGAGGCCTCTTTCTCTGCTGTGTATGTGTTCTCTCTGTGTCTCTCTTAAATTTCTCTCTCCCTTCCCCT
CCATTCTCCCCCTCGTTTTTTTCTCTTTCCCTCCCTCTCCTCCCTCCCTCTCCCTCTCAGGGTCTCACTGTGTAGCCCTA
GCTACAGGACTTANTATGTTCNAATCTCAACTCCTAGAAATCTGTTTGTTTCTGCATTCNNAGTGCTGGGATTAAAGGCN
TGTGCCACCAAACCCTACTTTTTCTTGAAATATACATAAGACTAAGTGTAAGTTCTGTGGTTATAATAAAGGTNNANTNA
AAAATATGAAAAAAAATTGTTCCCTGCANATGCANCTTAGAATATAANAN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser


Sequence tag IST12901D9BBF1
Sequence
CAACCNNCATTCCTTANGTGCANTGTGGTCACACTTTCTTGGCTACAGTCTTGCCCGTATCCTGTGGTCACATTTTCTTG
GCTACATTCTTGCCCATTCNATTACTGGTAGGTATACATGGAAATTTTATACTTTGTCCTTGATTAAACTGANAGAATTA
TAGTCTCACACAGAGGCCTCTTTCTCTGCTGTGTATGTGTTCTCTCTGTGTCTCTCTTAAATTTCTCTCTCCCTTCCCCT
CCATTCTCCCCCTCGTTTTTTTCNCTTTCCCTCCCTCTCCTCNCTCCCTCTCCCTCTNANGGTCTCACTGTGTANCCCC
Sequence Type genomic DNA
Unitrap ID UNI22626

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 57286710..57287027 296
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000063849 (Ppcdc) NM_176831 phosphopantothenoylcysteine decarboxylase Gene [Source:MGI Symbol;Acc:MGI:1914062]

 
Come back to gene ENSMUSG00000063849


For any suggestions or comments, please send an email to unitrap@crg.es