Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14579F3
Clone ID IST14579F3
Vector VICTR74
Project tigm

Sequence tag IST14579F3BBF2
Sequence
GGGTTGATGCAGTAGAGTGTCTGCCTAGCATGTGAGAGGCCCTGGGTTTGTCCTCAGCACTAAATACGGAAATAAAACTA
TTTCAGACTGCCATAGATCTG
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 30990656..30990755 100
NO GENE  


Sequence tag IST14579F3HMR1
Sequence
AAATGTGTACCAGACACCCATCAGTTCACCTTGGGGTGTCTCACGGTGACTGTTC
Sequence Type genomic DNA
Unitrap ID UNI31752

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 20542460..20542513 54
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000049800 (Sertad2) NM_001038625 SERTA domain containing 2 Gene [Source:MGI (curated);Acc:Sertad2-001]


Sequence tag IST14579F3HMF3
Sequence
ATTTCCTCTTGGACTTAGAGACTCAGTTTACATTTTCCAGGGGTATAGCACAATTAAGTGACATGTTTTCTCTTCTTTAA
TTTAATTAAATTAAAAAAGATTTAATTTTAATTTATGTGTATGGGTATTTTGCCTATATGTATGTCTGTGAACCACTTGC
TCAACTGGTGCCCAAAGAAACTAAAAACAGGTGTCAGGTCTCCTGGAACTGGAGTTC
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 20542248..20542463 216
NO GENE  

 
Come back to gene ENSMUSG00000049800


For any suggestions or comments, please send an email to unitrap@crg.es