Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST11305B1
Clone ID IST11305B1
Vector VICTR76
Project tigm

Sequence tag IST11305B1HMF1
Sequence
GTCTACACAGTGAGTTCCAGGACAGCCAAGGCTC
Sequence Type genomic DNA
Unitrap ID UNI34151 UNI34152 UNI34153 UNI34154

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 1: 58495001..58495033 33
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000026035 (Ppil3) NM_027374 peptidylprolyl isomerase (cyclophilin)-like 3 Gene [Source:MGI (curated);Acc:Ppil3-001]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 10: 112346715..112346747 33
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 79261280..79261312 33
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000020716 (Nf1) NM_010897 neurofibromatosis 1 Gene [Source:MGI (curated);Acc:Nf1-003]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 12: 78079003..78079035 33
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 14: 53041087..53041119 33
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 16: 35780225..35780257 33
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 22958923..22958955 33
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 18: 6148220..6148252 33
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 19: 47864498..47864530 33
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000025067 (D19Ertd652e) Putative uncharacterized protein [Source:UniProtKB/TrEMBL;Acc:Q9D669]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 152540910..152540942 33
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 38962486..38962518 33
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 140501500..140501532 33
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000028927 (Padi2) NM_008812 peptidyl arginine deiminase, type II Gene [Source:MGI (curated);Acc:Padi2-001]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 6: 90482820..90482852 33
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 120104344..120104376 33
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr X: 39557804..39557836 33
NO GENE  

 
Come back to gene ENSMUSG00000028927


For any suggestions or comments, please send an email to unitrap@crg.es