Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST12237D6
Clone ID IST12237D6
Vector VICTR76
Project tigm

Sequence tag IST12237D6BBF1
Sequence
CTTCCAGCTGTGGGTAGAAATGCTCAGAAAATCAGATTTGAGTCTTCACAGGGAAACTTCACTATGAGGATAATTCCTAA
AAGACAAAAGATGTATCTGATCTAAAGAAACACCAGAGTATTATTAGGGGAATTTATATAAAATTGTGATTTTGTCATGG
AACAGGCAGATGTTTTGGTCCTAAGTATTTTAGCTTTGCCTTTCTGTAGTTGCAGTATGTGATAGGAATCAGTGATTCCT
GACACAGTTCTTTGGCCGCCATAAGACCGTGAAGTAAGCAGTTATGTTCAGACCCTACCCGTCCCCATTCCTTCCAAAGC
TATTGCAGATGAATTGCGGAGCTGTTTATTCATTTATGGAATAAAGACGTTAAATCCTAAGTCTGGGGCTTAGTTTTTTC
CATTCCNATGAAGTACTACAGATTTTACTCACACTTCCGAATCCNGCTTTCCCTTTTATCTTTTTTTCTTTCTTTTTTTT
TTN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 95022955..95023436 478
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000053192 (Mllt11) NM_019914 myeloid/lymphoid or mixed-lineage leukemia (trithorax homolog, Drosophila); translocated to, 11 Gene [Source:MGI (curated);Acc:Mllt11-001]


Sequence tag IST12237D6HMF1
Sequence
CTTCCAGCTGTGGGTAGAAATGCTCAGAAAATCAGATTTGAGTCTTCACAGGGAAACTTCACTATGAGGATAATTCCTAA
AAGACAAAAGATGTATCTGATCTAAAGAAACACCAGAGTATTATTAGGGGAATTTATATAAAATTGTGATTTTGTCATGG
AACAGGCAGATGTTTTGGTCCTAAGTATTTTAGCTTTGCCTTN
Sequence Type genomic DNA
Unitrap ID UNI16036

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 95023235..95023436 202
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000053192 (Mllt11) NM_019914 myeloid/lymphoid or mixed-lineage leukemia (trithorax homolog, Drosophila); translocated to, 11 Gene [Source:MGI (curated);Acc:Mllt11-001]

 
Come back to gene ENSMUSG00000053192


For any suggestions or comments, please send an email to unitrap@crg.es