Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST13030D3
Clone ID IST13030D3
Vector VICTR76
Project tigm

Sequence tag IST13030D3HMF1
Sequence
AGATAAAAACCACGTACCACTGCCTCCAACCTCTTGCAGTTAACG
Sequence Type genomic DNA
Unitrap ID UNI14352

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 114416573..114416616 44
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000031952 (Chst5) NM_019950 carbohydrate (N-acetylglucosamine 6-O) sulfotransferase 5 Gene [Source:MGI Symbol;Acc:MGI:1931825]


Sequence tag IST13030D3BBF1
Sequence
AGATAAAAACCACGTACCACTGCCTCCAACCTCTTGCAGTTAACCTGTGTGGGAACAATGGGNNCCCTAGTCCCTANGNN
NNAAGCCTCGTANGACTTGGGCTCTGAGACACCCTGAGTGGCTATTAGAAGTTCTTCCTCATTCTTGAATTTCAGTACCA
GGGTCAGATGGCACTGCTTCTAGTACACAAGCCACTTAAGAAGAACTCCGGCTTTCCTAGAACACAGGTGACAAACACCT
TGGCTTGGGTCAAGACNAAGTCCTGGCCAGGCATCTGCCTTTGGTTTGGGAGAAAGCAAGANAATAATCTGAAGTGGAGT
AAACCTTCANACTGNCNTGGGAAGTTCCAGGGACTTCCAAACTGGNAGTCCTGANCTAACCCTGCCTGCATCTCCCCTCT
AAGCCTCGAATCCTCCAACTNAAN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser

 
Come back to gene ENSMUSG00000031952


For any suggestions or comments, please send an email to unitrap@crg.es