Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST13549A9
Clone ID IST13549A9
Vector VICTR74
Project tigm

Sequence tag IST13549A9HMF1
Sequence
NCAGGATGGANAGCGAGTTTCCCCATCACTGTTAAGTACACATCTTGTCTCAGTCCATGATACGGGAATGC
Sequence Type genomic DNA
Unitrap ID UNI34156

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 34723726..34723794 67
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000015468 (Notch4) NM_010929 Notch gene homolog 4 (Drosophila) Gene [Source:MGI (curated);Acc:Notch4-001]


Sequence tag IST13549A9HMR1
Sequence
CTGCCNCAGCATAAGAGCCTCTAGTCTGTCCCCACTGCGCCTGTATTTTGAACTTCACCTCCTTACCGCTCTCCCCAACA
TTCCAATAACACAGCGGCTCCATGCATACCCCTTTTATCCCTGGCTCCTACATCTGCTCGGGCTGCGATCAATTCTTCAA
CCAGGTCCTCCACGGCCAGCCTGGCAGCCAGCATCAAAGGTGTAGTCCCGTCCTCTGTGCGGGCGTCCACCGTAGTCTGT
CT
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 34723487..34723728 240
NO GENE  

 
Come back to gene ENSMUSG00000015468


For any suggestions or comments, please send an email to unitrap@crg.es