Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone CMHD-GT_140B4-3
Clone ID CMHD-GT_140B4-3
Vector Gep-SD5
Project cmhd

Sequence tag CMHD-GT_140B4-3
Sequence
AAGGAAGAAGTAGAACGCATTTTGTCTGAAGTAGGAAAGGCGGCCTGGTCCAACTTCAATGGAACGTATAAAAAAATGAA
CATTCCTGAAGGTGTGTCTTCACATACTTTAAAGAACTCCGATGTCAAATTGATGAAATCAATTGACCTTCAGGCAGCAA
GCTGAAGCCACTACTGAACCCCAAGTACTGAATGACAGCAAACCCCTGAGAATTGTCTCCATGCCCCTTTCAGCCCATCC
TTATGATTCAGGAGACAATAGCAATGGTCTCCTCAGTATGCCCAGGATCCTCTGCCCTGAGTGACAAGGACAAGAACAGT
TGGAGGAAATGGGCATTGTTGTAATCAGCTCCTTAATAAACACTCCCTGCATGCG
Sequence Type mRNA
Unitrap ID UNI14076

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 154096745..154096977 233
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000067998 (4833413D08Rik) NP_780376 RIKEN cDNA 5430413K10 gene Gene [Source:MGI Symbol;Acc:MGI:1918675]

 
Come back to gene ENSMUSG00000067998


For any suggestions or comments, please send an email to unitrap@crg.es