Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14527F4
Clone ID IST14527F4
Vector VICTR74
Project tigm

Sequence tag IST14527F4HMR1
Sequence
NNGNGAGATCTGCAGANGGCCNTTGCCCACGCGTGGGTTCCACACCTCTTGTAAGAGGAATCCGAGTTGTGTCCTCCACG
CTGAGCCTCCCTCTCCGGCCCTGTGCACACGGTTAGACCCGAAAACTTGGCATAAGTTTCCCGCGCGTGGCTCGGGGCAT
TGCACAGCCACTGCGCATGCGTGCTTCTGCATCCGTTGAGGGGCAACTTGAGAGGAATCCTCCACGCTGCACCTGGTTTT
TNACTCTCCTGGGTGCCGCTAANGTTCNCGGGAAACGCGTGGGGTCCGGCGN
Sequence Type genomic DNA
Unitrap ID UNI15335

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 56443194..56443480 277
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000001228 (Uhrf1) NM_010931 ubiquitin-like, containing PHD and RING finger domains, 1 Gene [Source:MGI (curated);Acc:Uhrf1-002]


Sequence tag IST14527F4HMF1
Sequence
ACCCCACGCGCGGGAAAGTTTTGCAAAGCTCCCCCCCACGACCCGGGCCGTCC
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 56443142..56443193 52
NO GENE  


Sequence tag IST14527F4BBF1
Sequence
ACCCCACGCGCGGGAAAGTTTTGCAAAGCTCCCCCCCACGACCCGGGCCGTCAACGTAGTGCGCCTGACCAGTAAGAGGG
CTAAGCGTAAAAAACACCCATCGGATCT
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 56443087..56443193 103
NO GENE  

 
Come back to gene ENSMUSG00000001228


For any suggestions or comments, please send an email to unitrap@crg.es