Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST12227B8
Clone ID IST12227B8
Vector VICTR76
Project tigm

Sequence tag IST12227B8BBF1
Sequence
AAGGCATGGTTTCTCTGTGTAGCCACTCCTGTCCTGGAATTCACTGTGTAAACCAGGCTGGCCTCAAACTTAGAGATCTG
T
Sequence Type genomic DNA
Unitrap ID UNI24228

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 123392218..123392297 80
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000029475 (Fbxl10) NM_001003953 F-box and leucine-rich repeat protein 10 Gene [Source:MGI (curated);Acc:Fbxl10-003]

 
Come back to gene ENSMUSG00000029475


For any suggestions or comments, please send an email to unitrap@crg.es