Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone CMHD-GT_139A5-3
Clone ID CMHD-GT_139A5-3
Vector Gep-SD5
Project cmhd

Sequence tag CMHD-GT_139A5-3
Sequence
AGCTGATTTATCCAGCGCCCAGCATGGGGTTTCCTGACTGCCGTGACTCAAGGCCTGGTGCGGGGAGCTGACAGGATGAG
CAAGTGGACAAGCAAGCGGGGACCACGCACCTTCACTAAGAGTCGGGGTGCCAAGAAAACAGGCATCTATACTTCTGATA
GGAAGTTTGTGCAAATAAAAGAAATGGTTCCAGAATTTGTCGTCCCGGACTTGACGGGCTTCAAGCTCAAGCCCTACGTT
AATTACCGAGCTCCTGCAGGCATAGACACACCTCTGACCGCCAAAGCGCTCTTCCAGGAAACAGTTGCACCCGCTATCGA
AAAAGACTTTAAAGAAGGGACATTTGATGCTAACAACCTGGAGAAATACGGCTTCGAGCCCACACAGGAAGGCAAGCTGT
TCCAATTATATCCTAAGAATTTCCCACGCTAGAAGACCATGAGAGAGGCCAAAAGTTTGTCTACAAAGTGGAGACAGTAC
TGACCAAGCCTTGGATTCTTATTGTCTCAAAGAGTAGGGGCAGCTTCCTAGCGCACTTCTATTAAATGCCTTTAGTGTCT
CGTGC
Sequence Type mRNA
Unitrap ID UNI13909

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 24829640..24830201 557
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000036850 (Mrpl41) NM_001031808 mitochondrial ribosomal protein L41 Gene [Source:MGI (curated);Acc:Mrpl41-001]

 
Come back to gene ENSMUSG00000036850


For any suggestions or comments, please send an email to unitrap@crg.es