Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14390B10
Clone ID IST14390B10
Vector VICTR74
Project tigm

Sequence tag IST14390B10BBF1
Sequence
TATGCAACAACCAGCGATCCAGATGTTAATCCCTGCTGTGATGCAATGATAAAATACCCAAGGCATGGAGCCCATTTACA
AAACAAATTTAAACAAGAATTACTATATACTCAAGAATCTTGGAATGAGCCATTCACAGTTCTGAGAGAATTACATTTAA
ACTCTTCCTTTGGGTGATCTTTTAGCTGCGTGTCTCCCAATTCCCTCCCAATTCCCTACAAAATCCTCGTAACCGCGGTT
TAATTTGGGTTTTTAAAAGGACCGACTGAAGGGGAAAGGGAGACCGGCATCAGGTGGTTACGTTAGAGTCTACTTTTGAT
AAGATAGCCGCGTAAATTCCCAGAAGGGATTCATCTATTCCGTCATTCTTGCCCATGCACAATAATCGTANTAAAATACG
ACCCAGATCCCGGANCCNCTAGCCACCCCGGACTCGCTCCATCCTCCCATCTCCGGTGGCACAGGCCTCTCTCTCTCTCN
NAGCTCTGCGTGATGGGCGGCTGANAACCCTGGGACGGAACN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 13: 97841989..97842509 509
 
EST/CDNA Est Name
  CX733968.1


Sequence tag IST14390B10HMR1
Sequence
CATAATACACACATGTGAGCCCTGGAGGAAAATCTTCTAC
Sequence Type genomic DNA
Unitrap ID UNI14955

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 13: 97842506..97842544 39
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000041817 (B230112C05Rik) family with sequence similarity 169, member A Gene [Source:MGI Symbol;Acc:MGI:2444268]


Sequence tag IST14390B10HMF1
Sequence
TATGCAACAACCAGCGATCCAGATGTTAATCCCTGCTGTGATGCAATGATAAAATACCCAAGGCATGGAGCCCATTTACA
AAACAAATTTAAACAAGAATTACTATATACTCAAGAATCTTGGAATGAGCCATTCACAGTTCTGAGAGAATTACATTTAA
ACTCTTCCTTTGGGTGATCTTTTAGCTGCGTGTCTCCCAATTCCCTCCCAATTCCCTACAAAATCCTCGTAACCGCGGTT
TAATTTGGGTTTTTAAAAGGACCGACTGAAGGGGAAAGGGAGACCGGCATCAGGTGGTTACGTTAGAGTCTACTTTTGAT
AAGATAGCCGCGTAAATTCCCAGAAGGGATTCATCTATTCCGTCATTCTTGCCCATGCACAATAATCGTAGTAAAANACG
ACCCAGATCCCGGAGCCNCTC
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 13: 97842090..97842509 416
 
EST/CDNA Est Name
  CX733968.1

 
Come back to gene CX733968.1


For any suggestions or comments, please send an email to unitrap@crg.es