Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14986C10
Clone ID IST14986C10
Vector VICTR76
Project tigm

Sequence tag IST14986C10HMR1
Sequence
TGTGACCCAACCGTCTGTCTAGGGAGGAGAGGGTCC
Sequence Type genomic DNA
Unitrap ID UNI31284

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 69359963..69359997 35
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000005237 (Dnahc2) NM_001081330 dynein, axonemal, heavy chain 2 Gene [Source:MGI (curated);Acc:Dnahc2-001]


Sequence tag IST14986C10BBF1
Sequence
ACACCNANNAAGAAGCTGCCCCGCGTGGCCCTCCCAGGCCCGCGCCTGCATGCACGCGTCGCCATGGCAACTCGGGGCCG
GGAGAGTAAGTGGCGGGTCTGCGGACACTGCGCAGGCGCACTGCTCCGCGGCCCCACCCCACNANAGTCTTTCCCGCGTG
GATCTGAGACTAAAGGGCAAGGGGGGGCGCGGCTAGGGTTTCGAGAGCTACTAANTCTGGGAGCCGAAGGTGCGGGGGAC
GGCTCCCGCCTGGATTTGAGGACTATGCTGGAANAGCTGGGACTGAAAACAATGAGACACGGTCTCNCAGGATGTGGAAA
AGACAGGGGA
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 69359995..69360323 313
NO GENE  

 
Come back to gene ENSMUSG00000005237


For any suggestions or comments, please send an email to unitrap@crg.es