Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14281H12
Clone ID IST14281H12
Vector VICTR74
Project tigm

Sequence tag IST14281H12HMR1
Sequence
TATCTANNTATCTATCTATCTATTTTTGGCTTTTTGAGACAGGGATGCTCTGTGTNCCTTGGCTGTCCTAGAACTCACAG
AGATCCACCTGCCTCTGCCTCCACACTCTGGTGACCCAGTGGATGACAAGGGAGGGAGGGTGAGGCTANTGGCCN
Sequence Type genomic DNA
Unitrap ID UNI22980

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 96808664..96808818 143
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000078700 (D030028A08Rik) RIKEN cDNA D030028A08 gene Gene [Source:MGI Symbol;Acc:MGI:2441931]


Sequence tag IST14281H12HMF1
Sequence
GATAGATAGATAGATAGATAGATAGATAGATGTGTGTGCCCGGCATGGTGGTGCATGACTGTAATCTCAGTACTAAGGAG
GCAGAGGCAGGGGGATGTCTGTGAGTTTATGGTCC
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 96808558..96808671 114
NO GENE  

 
Come back to gene ENSMUSG00000078700


For any suggestions or comments, please send an email to unitrap@crg.es