Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST10562G12
Clone ID IST10562G12
Vector VICTR76
Project tigm

Sequence tag IST10562G12HMF1
Sequence
GTCCTCCCATTGCTTTGTTTTGAAGGAATTTGAATTTTACTGGCAGATTTTGTCTGANTGCACGCAAGTTCTTTGCTATT
CATGCTCTTGTGACCTTGGACTTATCCTTAACTGCGTTCCTTCCTTAGAGTTTCGTGATTTGTAAGTGTATTTGCCCCGA
CCCCTTCANCAAACATAACAATTCTGAAAGCTTGGGGTTGAGGGTTCCCATTGTTTCCTGTGGGGTTTATTCAGAAGTTT
GGCAGGCTTGAGAGGGTGTGTTTGGGTGTGTGTATTTGTGAAGCNNANACTGGAAAAGTGAGCAGGAAGCCATGTGATAG
ACTGCTGTCCTGACTGTTTCCAGCACATTTGCTTCTGTGTTNANTGATCTCCATTTGTAGACNTGGGAACTTTGGTTTCC
CTGCTCCTGCTGTAACTNAGAATGAACACCCTTAGTTCTAAAACCCCGCANAAACACTTGCTCTTTANAGCACTTTNNAA
GTGCTGANTGTGCTANGNANANCACTTGCCNTACAGATAAATAATANCTCCTCTCTGTCTTTNNGGNTN
Sequence Type genomic DNA
Unitrap ID UNI25096

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 14: 27424817..27425358 502
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000040818 (A630054L15Rik) NP_001127937 family with sequence similarity 116, member A Gene [Source:MGI Symbol;Acc:MGI:2442980]


Sequence tag IST10562G12BBF1
Sequence
GTCCTCCCATTGCTTTGTTTTGAAGGAATTTGAATTTTACTGGCAGATTTTGTCTGANTGCACGCAAGTTCTTTGCTATT
CATGCTCTTGTGACCTTGGACTTATCCTTAACTGCGTTCCTTCCTTAGAGTTTCGTGATTTGTAAGTGTATTTGCCCCGA
CCCCTTCANCAAACATAACAATTCTGAAAGCTTGGGGTTGAGGGTTCCCATTGTTTCCTGTGGGGTTTATTCAGAAGTTT
GGCAGGCTTGANNNGGTGTGTTTGGGTGTGTGTATTTGTGAAGCANNNACTGGAAAAGTGAGCAGGAAGCCATGTGATAG
ACTGCTGTCCTGACTGTTTCCAGCACATTTGCTTCTGTGTNNAGTGATCTCCATTTGTAGACNTGGGAACTTTGGTTTCC
CTGCTCCTGCTGTAACTNAGAATGAACACCCTTAGTTCTAAACCCCGCANAAACACTTGCTCTTTANAGCACTTTCAAAG
TGCTGANTGTGCTANGNANANCACNNGCCATACAN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser

 
Come back to gene ENSMUSG00000040818


For any suggestions or comments, please send an email to unitrap@crg.es