Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST11406G1
Clone ID IST11406G1
Vector VICTR76
Project tigm

Sequence tag IST11406G1HMR1
Sequence
NNNACACTCATACACACACACACACATATATATATACACACACACATCACATATATATACACACACACATATACACATCA
CACANTCATATACACACATCACACACATATATATTTATACACACACACACACN
Sequence Type genomic DNA
Unitrap ID UNI30065

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 45590252..45590380 127
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000023935 (Spats1) NP_081925 spermatogenesis associated, serine-rich 1 Gene [Source:MGI Symbol;Acc:MGI:1918270]


Sequence tag IST11406G1HMF1
Sequence
GTGATGTGTATATGTGTATATATATGTGTGTGTGGTGTGTGTGTGTTTAAAGTATGGTGCCTTTTTTGTGGTACTGGGAG
TTAATACTAAAACCTTGCACATCAAAGCAAGTTCACCACCAATGAATTATATCCTCAGCCTTCCTTGCATCTTATAGGCA
CAAAGTAANTAAATATGAACTCTTTAAGGGATTTTTGCNTCCTATCTCACTGCTACCCACCCCTTTAAAAATCGTTCCTA
TACANANACTATGGAAAAGGTTCAGTGAGTATGANATGCTGTGAAGCCNACAGGATCTGGATTTCAAATTCCCAGCACCC
ACATAAAANCCNGGCACAACTGGGTATGCTTGTGACCCCAGCGATAGGGGCANANACAGGCANATCCTANNTACTCACAN
GCCAACTGACCTGGTCAAAATGTCNAGCTCTANGTTCANANANATCCAGTCTAAAAANNTAANTGCANAAAGCNNTNNAN
AAAAC
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser

 
Come back to gene ENSMUSG00000023935


For any suggestions or comments, please send an email to unitrap@crg.es