Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone AG0498
Clone ID AG0498
Vector pGT0lxr
Project sanger

Sequence tag AG0498
Sequence
CAAGGGACCCTATCCTACCCTCTAGTGTCCGTTTTCAGTGAACTGGAAGATCCAAGAAACGCCCAGCTTCTCTATCTGCT
CGCGGTCGCTGTTGTCATCATCCTGTTCTTCATCCTGCTGGGGGTCATCATGGCCAAGCGGAAGCGCAAGCATGGCTTCC
TCTGGCTGCCGGAANGGGTTCACCCTTCCGCCGAGACTCTAGCAATCACAAGCGCCGTGAACCTGTGGGACAGGATGCCG
TGGGGCTGAAAAATCTCTCCGTGCAAGTGTCAGAGGCTAACCTGATTGGTTCTGGGACAAGTGAACATTGGGTTGATGAT
GAAGGACCCCAGCCAAAGAAAGCCAAG
Sequence Type mRNA
Unitrap ID UNI2283

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 97942415..97943605 199
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000027878 (Notch2) NP_035058 Notch gene homolog 2 (Drosophila) Gene [Source:MGI Symbol;Acc:MGI:97364]

 
Come back to gene ENSMUSG00000027878


For any suggestions or comments, please send an email to unitrap@crg.es