Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST10610A9
Clone ID IST10610A9
Vector VICTR76
Project tigm

Sequence tag IST10610A9HMR1
Sequence
TTGTTCGTTGGGATTTTTGTTTNGTTTTCTCCAAAGCAAGAAGGCAAGATGACTCANCAGGTAAAAGTGCTTTGTCACAA
GCCTGAAGCCCTGGGTTTGATCCCTGCAGCCCTTGCTGGGAAGAGAGAACTGACTGAGAGGTTGTTCTCCTCTGTCCACA
AGTTCATGTCTGCACCCATACACATCATAACACACAGTTAAAAACAACCAAAAAGCATTAANAAACTCTTTTGCTGTTTT
AAAGTGTACAGGGACATTTTTTCAAAGTAAAATTTACTGGGTAAATGTTACCGGCAAGAAGAATTGTGTTTTATTTCTCA
CTGAANAGCTCACTGANAGCATTTTGAACAGTGTTTGCCTTGTACANCTGACAATAGTGCACATAGCANCATGAGCGTCT
TTCCTGCCTTGGCAGACTTCTGCGCAGCTNCTTCCCACTGCATCTGAATCNNCCTCCGACCTATTGCCTTTTCCCTANGT
GCGGCATTACAGCGCTANGN
Sequence Type genomic DNA
Unitrap ID UNI12322

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 10: 40638614..40639109 474
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000019831 (Wasf1) NM_031877 WASP family 1 Gene [Source:MGI (curated);Acc:Wasf1-001]


Sequence tag IST10610A9HMF1
Sequence
ACACTAAAACATTATAATGAAACGGTACAATTTCTCCCACAGATTAAGATCATTTTCTGTAGTCTTAATGG

Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 10: 40638546..40638616 71
NO GENE  

 
Come back to gene ENSMUSG00000019831


For any suggestions or comments, please send an email to unitrap@crg.es