Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14993C3
Clone ID IST14993C3
Vector VICTR78
Project tigm

Sequence tag IST14993C3HMR1
Sequence
GGGCTACTGTCCAACAACAACCAGGCTCTGCGGAGGTTCATGCAGACCTTTGTCCTTGCTCCTGAGGTATGTTGCTCTGT
ANTGATGGAGTACTTAAAGACTAAAAGCTGTGTGGAGTCCAGATTCCTGGCAGCTCAGGGTTATAGGTATGGCTGCAGGG
TAGAGCTGCTCTGTCCTCTTGTCCTAAAGCTGTGGTGCCCTCNCTGTAATCTTCANGAAGATGACTGTTGGGAGGAGCCT
CCCCTAAACTGTTGAAATGCAGGANACTTCNTGTCCCTTCGGCTGGCATCACCTANNGACAANGGATCTGTTTCCTAATC
ACCCTGTTGTCACCNNNTN
Sequence Type genomic DNA
Unitrap ID UNI2662

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 55302629..55302962 318
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000018583 (G3bp1) NM_013716 Ras-GTPase-activating protein SH3-domain binding protein 1 Gene [Source:MGI (curated);Acc:G3bp1-001]


Sequence tag IST14993C3BBF1
Sequence
GCCCCATCACTTGGACNNCCACCCCGTCATTCAGAGTTGCGTGAGCATCCACGTGGCGGATCTTGGTGTGGCAGTTGGTG
AAGTTTTGTGACATCACTTTCCTGTGGATTTCCTGAGGAATGGAGGCAAGAGTCAATCCCCCAGGAACTCACCAGTTCAG
AAACTAAAACAGCAGTTGCCAGCACCAAGAACAGACTGGCAGATCCTCCAAGCTCCGCCCTGTTTTCTCACAGATGTGTA
CTTGACACTCAGCCCTGCTTCCTCCTGCTCCTTCGCACAGTGGTTGAGCAGTCTCCAAGCAATCTGAAGAGCTATACAAC
AAGTACACTGAAGGGCANAGACCTGCTACGCTCACACCAGCTCATCTCCACTCANCGTGACNAGACCTANAATCANNNAN
GANACNCTCTGCTGGGACAGCNNCATTGCNCAGGCNAA
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 55302198..55302632 405
NO GENE  

 
Come back to gene ENSMUSG00000018583


For any suggestions or comments, please send an email to unitrap@crg.es