Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14560E5
Clone ID IST14560E5
Vector VICTR74
Project tigm

Sequence tag IST14560E5HMR1
Sequence
NAAGCAGGCAGATTTTGTGGGTTTGAGACNNGCCTTGTCTACATAGAATATTCCAGGCCAGCCAAGGGCTACACAGTGAG
ACCCTGGCTTAANAAAAAAGAAATATGTAGACCAACATGAAGGTATGATGGCTGATGGGGCATGTAATCTCAGATTGGGA
AGCTGAGATAGGGGTTTGAAGATAGGGGTCTGTATTGTAAGACCCTCCTTTAAATCAAACCAACCAACCAACCAACCNNA
NTAGTCANAGGGANAANCN
Sequence Type genomic DNA
Unitrap ID UNI16126

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 116751950..116752204 239
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000031024 (St5) NM_001001326 suppression of tumorigenicity 5 Gene [Source:MGI Symbol;Acc:MGI:108517]


Sequence tag IST14560E5HMF1
Sequence
CTTATGTCTCCTTCAGTCNCAGTGATGGGACTAAAGGCTTGCACCACCACACCAGACAAGCAAAGTAGAGCTCTGATCTG
TTGCTCACCAGGGGATTCATAAAAACTGCCATGGTGCAAATAAAGGAAGGGACATCACAAGCCCCACAGATTAGCCACAA
ATATTGCTTGGTTTGAAAGAGAGTAATGAATACAAAAATAGCTAACATTCTGTCCAGCAACAAGGTAGGAAGTACTAGCC
TTTACGCGTAGGCTTCCCTGCACGACTCTCAGATACATCGTTCACTGCCTTGGTTAGAGAGCTTTCTGGGTGGTGGACAA
GCCAGGCAGCACTGAGAACCATGTATGCGGCTGAATCACCAGGTAGCTGGAATTCAGGCTGACTGCAGGCCAGCTCCAAA
CATTCCGCTTGTGTGACTCTTTCTCTAACATCCTTTGTCTTTACCCATCNACTGGTCACTCAAACTCTGACNNGANTCCT
TCAGANAGTGTTGCAACTTTTCCTTTTCNANANTNGN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 116752202..116752709 496
 
EST/CDNA Est Name
  CA890489.1 - CA890519.1 - BB870071.1 - CN461371.1 - CB244737.1 - CN460498.1 - BY753064.1 - CF727398.1 - BF535503.1 - CK638702.1 - CN460946.1 - CN460569.1 - CD348626.1 - BM461102.1 - BI685813.1 - BU562111.1 - CN663728.1 - BY066411.1 - CN458552.1 - BY071647

 
Come back to gene CA890489.1 - CA890519.1 - BB870071.1 - CN461371.1 - CB244737.1 - CN460498.1 - BY753064.1 - CF727398.1 - BF535503.1 - CK638702.1 - CN460946.1 - CN460569.1 - CD348626.1 - BM461102.1 - BI685813.1 - BU562111.1 - CN663728.1 - BY066411.1 - CN458552.1 - BY071647


For any suggestions or comments, please send an email to unitrap@crg.es