Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14729F9
Clone ID IST14729F9
Vector VICTR76
Project tigm

Sequence tag IST14729F9HMR1
Sequence
ATTCTAGTGGCTTTGTCTTTGGCTCACTTAGTCNTAATTAATGTTTCCNCACCCTCTGAAGGAGACCCAGACCTGCAGGG
AGGGCAGTGCTCTAGTAGTTGGGCCTTGGGCACTACCACAGTGGTCCCCTGTCTATAGATGATACCCTTTGAGTTAAAGC
ATAAAAGAGAATTGAGTTTAGAGACCTGGACAATTTGTGCTTTCTGGTTCAAAGGATTTCATTATTTTAATATTATGATC
TGTTGTTTTTACTTCTGTCTCTGCTTTGTTTTAGGAAGACACCAGGCACTGTTGTTGGCAGTTTTTGTGACTCCTCTTAT
TGATCTTCGTTCTGATTTTTNNAAATTTCNAGAAATGATAGAAACNACTTTANATATGGATCANGTATGCNATTCACATT
TNATTCCCACNGCANAGTATTTTTGGAANGGAAAAAGTAACCANAAACAACAGANAAATCATATTNNAAAATGTCTAANT
TTGTCTTGAGTNNNTATN
Sequence Type genomic DNA
Unitrap ID UNI5181

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 88095561..88096050 453
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000024151 (Msh2) NM_008628 mutS homolog 2 (E. coli) Gene [Source:MGI Symbol;Acc:MGI:101816]


Sequence tag IST14729F9HMF1
Sequence
GAATAAGACCTAATTTGCATCCTAATTTCCATTAACAACCCAGCGCTCCAATCAGCAGAGGCTGAATCCAGTGCTTAAAT
TGGAACTTGGCGGTTGAGAGCCATCCCGANGAATCGTGGGAGGAGGGGAACAGGAACCAACAATGTGCAAGAAGGCAGAG
TCAGGGCTGGCGCTAGCCCGGGCATGCTGCTCTGTGGCTTTCTCATCCTCAGCACAGCCCTGTCCTGANCCCTGTCCTTG
TCTGCACAAGGTANTGACNATGACAACTACCCAGANGATAGGTGCGTGCCTGANACNACNCAGCNNCNNGCAGTGCCCCA
CGCCNAACANTCANNATACACTACNCCNCAAT
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser

 
Come back to gene ENSMUSG00000024151


For any suggestions or comments, please send an email to unitrap@crg.es